Intelligent Design - Értelmes Tervezettség

Az intelligens tervezettség és az evolúcióelmélet vitája
Gorni
Hozzászólások: 894

Intelligent Design - Értelmes Tervezettség (9698)

HozzászólásSzerző: Gorni » 2011.01.05. 20:40

@vaskalapos (9605):
Nem erted a lenyeget. Hogyan szallitja a csiga vere (hemolimfa) az oxigent?

Nyilván a természeti törvények szerint. Az adott speciális molekula az egyik helyen felveszi az oxigént, egy másik helyen leadja. Közben egy másik 'kör' mozdítja az első helyről a másodikra. És épp ahol leadja, egy újabb vegyi folyamat már fel is használja az oxigént (ha pl. korábban szabadult volna fel, akkor tönkretett volna néhány jól működő vegyi folyamatot, ami biztosította a csiga életben maradását.
Hogyan jött létre ez a néhány ciklikusan működő vegyi folyamat? Mi volt az előzménye (amikor még nem volt hemolimfa, pl. a laposférgekben az emésztőcsatornából közvetlenül kerültek a szükséges vegyi anyagok a testi sejtekhez. A két állapot közötti átmenetek lennének az érdekesek - véletlen változásokkal, szelekcióval.

Avatar
sajnos_kacat
Hozzászólások: 680
Tartózkodási hely: Budapest

Intelligent Design - Értelmes Tervezettség (9699)

HozzászólásSzerző: sajnos_kacat » 2011.01.05. 20:43

@Gorni (9698):
Pontosan így történt. Véletlen változásokkal, és szelekcióval.

Avatar
énkérdezek
Hozzászólások: 505
Tartózkodási hely: Hungary

Intelligent Design - Értelmes Tervezettség (9700)

HozzászólásSzerző: énkérdezek » 2011.01.05. 20:48

@Gorni (9698): Hogyan jött létre ez a néhány ciklikusan működő vegyi folyamat? Mi volt az előzménye (amikor még nem volt hemolimfa, pl. a laposférgekben az emésztőcsatornából közvetlenül kerültek a szükséges vegyi anyagok a testi sejtekhez. A két állapot közötti átmenetek lennének az érdekesek - véletlen változásokkal, szelekcióval.


Pontosan erről van szó!!!!
Hogyan tudnád bizonyítani, hogy itt tervezés történt?
Mikor és milyen folyamatokba nyúlt bele kicsoda, hogy ezek így alakuljanak?
Milyen bizonyítékok állnak rendelkezésedre, amik alátámasztják a tervezést?

Tudod, az nem bizonyíték, hogy: MERT CSAK!
Mert erre én azt mondom, hogy :MERT CSAK NEM!!!
Ezzel egy-egy az állás, tehát rukkolj elő valami erősebb bizonyítékkal.......

Gorni
Hozzászólások: 894

Intelligent Design - Értelmes Tervezettség (9703)

HozzászólásSzerző: Gorni » 2011.01.05. 20:52

@sajnos_kacat (9609):
Soha senki nem mondott olyat, hogy bármiféle funkció megvalósítása felé törekedne az evolúció.
Mit értesz információ alatt, és hogy jön ez az evolúció elméletéhez?

For there to be information, there must be a multiplicity of distinct possibilities any one of which might happen. When one of these possibilities does happen and the others are ruled out, information becomes actualized.
Az információ mondja meg a molekuláknak, hogy egy az élethez szükséges jelenséghez hogyan járuljanak hozzá. Mert számos lehetséges variációt engednek meg a természeti törvények, mégis a vegyi reakciók épp úgy alakulnak, hogy az egyik végterméke a másik alapanyaga, és az egész egy stabil állapotot eredményez az állandóan változó környezetben.

A vénusz légycsapójának működéséhez milyen információk szükségesek, és ezeket ki magyarázta el a növénynek?

Nem elmagyarázza, beprogramozza. A tervező, a kivitelező.
Mint amikor robotokat programoznak a mérnökök, hogy egy bizonyos környezetben, egy bizonyos jelzésre egy adott folyamatot végezzenek el az összes beprogramozott munkafolyamatból, és egy másik jelzésre egy másik folyamatot, és az egész segítse a robot jelenlétét, fennmaradását, és munkavégzését.
A nem beprogramozott robotok hamar elveszítik az elraktározott energiájukat, míg a beprogramozottak felvesznek energiát a környezetükből, és tovább folytatják a munkát.
Ha a vénusz légycsapót egy robotnak tekinted, akkor az információ kifejtődése az életjelenségek sorozata, amit a vénusz légycsapó kivitelezője programozott be (valószínűleg a DNS-ébe), és a tervezője alkotott meg (valamikor az élet kezdetén).

Gorni
Hozzászólások: 894

Intelligent Design - Értelmes Tervezettség (9704)

HozzászólásSzerző: Gorni » 2011.01.05. 21:03

@énkérdezek (9700):
Hogyan tudnád bizonyítani, hogy itt tervezés történt?

Másként tenném fel a kérdést:
Miért tartod a tervezettséget jobb magyarázatnak a fent említett fajspecifikus vegyi folyamatok eredetére, mint a véletlen változások + természetes kiválasztódás lépéseiből álló evolúciós magyarázatot.
Azért, mert az adott vegyületek között számos másféle reakció is lezajlódhat, ha pusztán a természeti törvények és a véletlen találkozások befolyásolják őket. A számos igen sokféle lehetőséget takar, de elsősorban azokat, amelyeknél a körfolyamatok nem maradnak fent, hanem egy viszonylag stabil állapotot elérve leállnak. Laborban utánozva a sejteken belül lezajló folyamatokat igen specifikus változások hatására történik csak meg ugyanaz, mint ami a sejtben. Ezért nem tűnik ésszerű magyarázatnak, hogy a nagyon ritka, véletlen egybeesések tucatjainak eredménye legyen a sejtek metabolizmusa.
Például, ha klorofillal szeretnénk energiát biztosítani az életjelenségekhez szükséges vegyi folyamatok számára, egy laborban nagyon nehéz lesz biztosítani az épp megfelelő körülményeket, olyanokat, amelyek rákényszerítik a molekulákat az életjelenség leutánzására. Ám végül sikerülhet, de sok-sok intelligencia kell hozzá. Ezt az intelligenciát feltételezem a természetben is, csak nem az ember, hanem valaki korábban élt lénytől eredően.
Bizonyítani csak azt tudom, hogy milyen nehéz leutánozni a természeti folyamatokat, milyen speciális elrendezéseket kell biztosítani, és ezeket az ismert természeti körülmények nem szokták egy helyen, egy időben létrehozni (ezért nagyon valószínűtlen magyarázat, ha mégis erre hivatkozik valaki). Az ilyen érvelést számos esetben elfogadják, a mindennapi életben és a tudományban is. Miért ne fogadjuk el hát a biológiai jelenségek magyarázatául is jó magyarázatnak?

Avatar
énkérdezek
Hozzászólások: 505
Tartózkodási hely: Hungary

Intelligent Design - Értelmes Tervezettség (9705)

HozzászólásSzerző: énkérdezek » 2011.01.05. 21:07

@Gorni (9704): @énkérdezek (9700):
Idézet:
Hogyan tudnád bizonyítani, hogy itt tervezés történt?

válasz:

Másként tenném fel a kérdést:


Aha. Másképp tennéd fel......

Szóval a taktika, hogy ha egy kérdésre nincs válasz, akkor tetszés szerint kitalálsz egy másik kérdést, amire úgy ahogy válaszolni tudsz.......

Erre mit írjak? - személyeskedni nem akarok, így inkább nem írok semmit......

vaskalapos
Hozzászólások: 4606

Intelligent Design - Értelmes Tervezettség (9719)

HozzászólásSzerző: vaskalapos » 2011.01.05. 22:03

@Gorni (9704):
Bizonyítani csak azt tudom, hogy milyen nehéz leutánozni a természeti folyamatokat


Igaz.

A napot sem tudjuk laborban utanozni. Nyilvan azt is intelligensen terveztek?
Vulkankitorest? Villamot? (villamot a levegobol, nem drot vegol szikrat, az nem villam)

Ha valamit nem, vagy csak nehezen tudunk laborban reprodukalni, az csak azt jelenti, hogy nehezen tudjuk, vagy nem tudjuk.

Bizonyítani csak azt tudom, hogy milyen nehéz leutánozni a természeti folyamatokat, milyen speciális elrendezéseket kell biztosítani, és ezeket az ismert természeti körülmények nem szokták egy helyen, egy időben létrehozni (ezért nagyon valószínűtlen magyarázat, ha mégis erre hivatkozik valaki). Az ilyen érvelést számos esetben elfogadják, a mindennapi életben és a tudományban is.


Nem a magyarazat valoszinutlen, hanem a korulmenyek egyuttallasanak a valoszinusege alacsony.

A tudomanyban es az eletben nem fogadjuk el azt az ervelest, hogy ha valamirol fogalmunk sincs, hogyan jott letre, akkor ismeretlen Intelligens Tervezot tetelezunk fel.
A hozzászólást 1 alkalommal szerkesztették, utoljára vaskalapos 2011.01.05. 23:27-kor.

Avatar
Gábor
Hozzászólások: 2318
Tartózkodási hely: Finnország

Intelligent Design - Értelmes Tervezettség (9728)

HozzászólásSzerző: Gábor » 2011.01.05. 23:02

@vaskalapos (9719): De hát mindent csak laborban tudunk reprodukálni, vagy legalábbis a reprodukálásban benne van az, hogy reprodukálni csak INTELLIGENSEN lehet. Így igen, amit mi csinálunk az intelligensen lett tervezve, tehát olyan, hogy természet nem létezik. Csak Villámisten, meg Vulkánisten ahová be kell dobni egy szüzet, hogy ne törjön ki...

Gorni
Hozzászólások: 894

Intelligent Design - Értelmes Tervezettség (9744)

HozzászólásSzerző: Gorni » 2011.01.06. 13:27

@vaskalapos (9719):
a korulmenyek egyuttallasanak a valoszinusege alacsony.

Igen, így helyes a megfogalmazás.
A tudomanyban es az eletben nem fogadjuk el azt az ervelest, hogy ha valamirol fogalmunk sincs, hogyan jott letre, akkor ismeretlen Intelligens Tervezot tetelezunk fel.

Tökéletesen igazad van. Kár volt hozzátenned, hogy a "tudományban", de megértem az óvatosságodat.
Szerintem viszont a "fogalmunk sincs" erős túlzás. Sőt. Az a gyanúm, hogy épp az evolúciós magyarázatra illik rá, hogy nem tudjuk "hogyan jött létre" - legalábbis a lényeget illetően (nem ismerjük azokat a lépéseket, amelyeken keresztül elvezetett a változás sorozat két ismert állapot között, pl. két kövület, egy kihalt és egy ma is élő faj között, stb.) Ráadásul a "fogalmunk sincs" és a "véletlen" között erős korreláció létezik.
Gondold el a következő szűkítési folyamatot.
Valaminek szeretnénk megtudni a történetét (hogyan jött létre?). Nehéz ügy, nem volta szemtanúk, túl hosszú a folyamat, megfigyelhetetlen a folyamat, stb. De azért próbálkozunk.
Megnézzük, milyen ismert folyamatok hoznak létre hasonló eredményt. Rájövünk, hogy háromféle kategóriát állíthatunk fel ezek számára:
1. Pusztán a természeti törvények feltétlenül létrehozzák, nincs mese, elkerülhetetlen az esemény, csak hagyni kell rá elég időt. (Ilyen a nappal-éjszaka, az évszakok ciklikkus váltakozása, a hópihe lehullása a földre (hacsak el nem párolog), a víz körforgásának részletei a Földön, stb.
2. A természeti törvények elég gyakran létrehozzák, néha sokat, néha keveset kell várni rá, néha több, néha kevesebb lépésből összegződik, van úgy, hogy egyáltalán nem jön össze a dolog, de azért lehet számítani rá. (Ilyen a drogrezisztencia kialakulása, egy folyón az uszadékfák összetorlódnak, gát alakul ki, és létrehoz egy kis tavat, ami előnyös néhány faj számára, a Mendeli törvények által meghatározott tulajdonságok kialakulása (ha a beporzás véletleneken múlik), stb.
3. A természeti törvények megengedik ugyan, de ahhoz igen változatos körülményekre van szükség, amelyek spontán bekövetkezése szinte lehetetlen. Ha viszont valaki tudatosan befolyásolja a körülményeket, akkor sikerül levezetnie a folyamatot (pl. laborban, ahol könnyen lehet befolyásolni a hőmérsékletet, nedvességtartalmat, elektromágneses teret, stb.).
A kulcs a "hasonló eredmény"-en van. Ezért említettem volt a nanotechnológiát, amely már csak a reprodukció képesség terén van elmaradva az élő sejtektől. Ma már NEM elképzelhetetlen, hogy sikerül önreprodukáló nanobotokat létrehozni, így amit az ilyen kísérletekből tudunk, azt jogosan feltételezhetjük a sejteknél is.

Ezzel egyébként két legyet ütünk egy csapásra. Az első, hogy rákényszerítjük az evolucionistákat is a mélyebb gondolkodásra, a második pedig, hogy esetleg a nanotechnológia felismerései segítenek megfejteni a sejtekben zajló folyamatok lényegét, és így elhárítani néhány betegséget.

Gorni
Hozzászólások: 894

Intelligent Design - Értelmes Tervezettség (9745)

HozzászólásSzerző: Gorni » 2011.01.06. 13:30

@énkérdezek (9705):
Szóval a taktika, hogy ha egy kérdésre nincs válasz, akkor ...

Eddig jó. Vannak kérdések, amelyekre nincs válasz. Ilyen a tudomány. De nem "tetszőleges" a folytatás. Ha "bizonyítani" nem is lehet 100%-ban valamit, de attól még lehet logikus magyarázatot adni rá, egy vagy több alternatív lehetőséget, és megvizsgálni, melyiket LEHET további kutatással bizonyítani. De ha valaki lusta végigjárni ezt az utat, akkor annyi.

vaskalapos
Hozzászólások: 4606

Intelligent Design - Értelmes Tervezettség (9750)

HozzászólásSzerző: vaskalapos » 2011.01.06. 14:26

@Gorni (9744):
Szerintem viszont a "fogalmunk sincs" erős túlzás.


Hat mondjad, mit tudsz az Intelligens Tervezesrol? Azon kivul, hogy kijelented, hogy terveztek, tudsz-e valamit?
Ki? Mikor? Hol? hogyan? Miert? Mivel?
Barmilyen reszetetet?
Barmilyen bizonyitekot?

Sokszor kerdeztem. Nem tudsz semmit. Fogalmad sincs.

Most is csak azt irod, hogy nem fogadod el a tudomanyos magyarazatokat. Eddig rendben van, jogod van hozza. De az egy logikai bakugras, hogy ha valaminek nem ismered az okat, akkr Tervezot feltetelezz, meghozza Intelligenset.

Akkor tetelezz fel tervezot, ha van ra barmi alapod, bizonyitekod. Nemtudasod nem bizonyitek.

Raadasul:
természeti törvények megengedik ugyan, de ahhoz igen változatos körülményekre van szükség, amelyek spontán bekövetkezése szinte lehetetlen


Szinte lehetetlen = lehetseges. (lehet, hogy kicsi a valoszinusege, lehet ritka esemeny; ezt bizonyitanod kene, mennyire ritka; ami teny: lehetseges, es az eredmenye itt van)

Ma már NEM elképzelhetetlen, hogy sikerül önreprodukáló nanobotokat létrehozni, így amit az ilyen kísérletekből tudunk, azt jogosan feltételezhetjük a sejteknél is.


Igen. Ha ismerjuk a laboratoriumot, a technologiat, a szakmai cikkeket, akkor feltetelezhetjuk, hogy ebbol kiindulva esetleg, valamilyen eselye van annak, hogy sikerulni fog a jovoben. De folytassuk a gondolatmenetet: ha egyszer sikerul a laborban mestersegesen eletet letrehozni nem lesz nyoma ennek a tortenelemben? Nem lesznek ennek targyi emlekei? Fossziliak?

Raadasul ehhez az kell, hogy legyen egy gondolkodo emberi civilazacio, fejlett tudmannyal. Te hallgatolagosan azt tetelezed fel, hogy az Intellgens Tervezo civilizacioja a semmibol keletkezett egy pillanat alatt, elozmenyek nelkul, es miutan elkovette a tervezest, kovetkezmenyek nelkul eltunt es eltuntette a laborjat is, es visszvonta az osszes publikaciojat.
Ennek mi a valoszinusege? Mi a magyarazata?

Arrol nem beszelve, hogy a te logikad sezrint az embert is terveztek, tehat a Tervezot is tervezni kellett es igy tovabb... a tervezo tervezojet is... stb
A hozzászólást 1 alkalommal szerkesztették, utoljára vaskalapos 2011.01.06. 18:02-kor.

érdeklődő
Hozzászólások: 7

Intelligent Design - Értelmes Tervezettség (9758)

HozzászólásSzerző: érdeklődő » 2011.01.06. 17:25

@Gorni (9703):


Gorni írta:
Nem elmagyarázza, beprogramozza. A tervező, a kivitelező.
Mint amikor robotokat programoznak a mérnökök, hogy egy bizonyos környezetben, egy bizonyos jelzésre egy adott folyamatot végezzenek el az összes beprogramozott munkafolyamatból, és egy másik jelzésre egy másik folyamatot, és az egész segítse a robot jelenlétét, fennmaradását, és munkavégzését.
A nem beprogramozott robotok hamar elveszítik az elraktározott energiájukat, míg a beprogramozottak felvesznek energiát a környezetükből, és tovább folytatják a munkát.
Ha a vénusz légycsapót egy robotnak tekinted, akkor az információ kifejtődése az életjelenségek sorozata, amit a vénusz légycsapó kivitelezője programozott be (valószínűleg a DNS-ébe), és a tervezője alkotott meg (valamikor az élet kezdetén).



Sziasztok!

Most frissiben csatlakoztam, ha megengeditek, csatlakoznék a vitához.

Amikor beprogramoznak egy robotot, egy adott célfeladat végrehajtására programozzák be. (Természetesen ez egy igen komplex feladat is lehet.)

Erre a feladatra megírják a programot, betöltik a programtárba, és a robot elvégzi a feladatot. Ha ez a program akárcsak 1 bitje is megváltozik, már kétséges a program eredeti feladatának teljesülése. Nem feltétlen lesz hibás, de nagy eséllyel más lesz a működése.
Ezt a tervező nem engedheti meg egy rendszernek.
Szerinted tehát aki a vénusz légycsapójának "létrehozó kódját, a DNS-t programozta", az megengedte ennek az igen fontos kódnak a felülírását? Miféle pancser programozó engedi megváltozni a jól kitalált kódot? Főleg ha az elsőre jól fut?

Gorni
Hozzászólások: 894

Intelligent Design - Értelmes Tervezettség (9785)

HozzászólásSzerző: Gorni » 2011.01.07. 00:35

@vaskalapos (9750):
Raadasul ehhez az kell, hogy legyen egy gondolkodo emberi civilazacio, fejlett tudmannyal. Te hallgatolagosan azt tetelezed fel, hogy az Intellgens Tervezo civilizacioja a semmibol keletkezett egy pillanat alatt, elozmenyek nelkul, es miutan elkovette a tervezest, kovetkezmenyek nelkul eltunt es eltuntette a laborjat is, es visszvonta az osszes publikaciojat.

Nem, nem feltételezem és nem mondom. Egy másik topikban részletesen kifejtettem, hogy van nyoma a tervezésnek, csak "legendának" tartják a "tudósok", akadémikusok. Miért tartják legendának? Több eset lehetséges. 1. Mert valóban az, mese, felnagyított vágyak. 2. Nem legenda, de amit leírnak, az túlmegy az akadémikusok képzeletén, és elviselhetetlen lenne nekik ezt bevallani (presztizsveszteség lenne). A fennmaradt irodalom hiányos is, sőt, nagyon hiányos, így reprodukálni az eredeti dokumentációt két okból is nehéz: a technológiája meghaladja a ma ismert technológiai képességeinket, és a megalkotott rendszer (világ) célja sem közismert.
Tehát egy szűkebb keretet kell kijelölni, ami empirikus módon is vizsgálható. Ez pedig a tervezés tipikus folyamata (számos elemzés készült már az alkotás folyamatáról), és a tervezett rendszerek tipikus helyzete, reakciója természeti körülmények között (robotok, automaták, energia-átalakító rendszerek).
Ez persze jóval kevesebb annál, mint amit te is szeretnél (ismerni az Intelligens Tervező civilizációját, történelmét, és motivációit, technológiáját, laboratóriumi eredményeit), de a semminél több. Sajnos az a helyzet, hogy "aki a kicsit nem becsüli, a nagyot nem érdemli". Ezt most nagyon komolyan mondom, és csak neked!
Ennek mi a valoszinusege? Mi a magyarazata?

A dokumentációk az idők során mindig eltűnnek, hiányossá válnak. A történészek, régészek tudnának erről mesélni. Ne légy naív, a pusztulás természetes, sokkal valószínűbb, mint a véletlen fennmaradás vagy felépülés.
Ha egy dokumentáció tartalomjegyzéke fennmarad, akkor legalább azt tudjuk, hogy milyen témák voltak egyszer leírva, de sajnos azt már nem, hogy pont mi állt az írásokban. Ez történt pl. India ősi írásaival. Ismert a tartalomjegyzéke, de a valóban fennmaradt írások az eredeti 10%-a alatt vannak.
Arrol nem beszelve, hogy a te logikad sezrint az embert is terveztek, tehat a Tervezot is tervezni kellett

Nem az egyetlen logikus következtetés az elsőből a második. A logika több lehetőséget is megenged. De ezt már többször is mondtam, csak sajnos a rögeszméd ez a fajta logika. Kár, pedig máskülönben sokszor nagyon jól vág az eszed.

Gorni
Hozzászólások: 894

Intelligent Design - Értelmes Tervezettség (9786)

HozzászólásSzerző: Gorni » 2011.01.07. 00:45

@érdeklődő (9758):
Erre a feladatra megírják a programot, betöltik a programtárba, és a robot elvégzi a feladatot. Ha ez a program akárcsak 1 bitje is megváltozik, már kétséges a program eredeti feladatának teljesülése. Nem feltétlen lesz hibás, de nagy eséllyel más lesz a működése.
Ezt a tervező nem engedheti meg egy rendszernek.

Számos hibajavító rész-programot kitaláltak már erre. A DNS-ben is van hibajavító egység, ami igyekszik a mutációkat kiküszöbölni. Egy rendkívül összetett programban (pl. az OP rendszerek) számos sérülést elviselnek. Vannak olyan helyek, ahol valóban végzetes akár csak egyetlen egység megváltozása. De a legtöbb nem ilyen, sőt, lehet olyan programot is tervezni, amelyik betervezetten használja ki a véletlen változások adta variációs lehetőségeket.
Az érzékeny részek az energia ellátás, a jelszinteket meghatározó programok, az alapvető beállítások (honnan vegye a rendszer az indító programot) stb. Beszélgess ügyes programozókkal, akkor szélesebb lesz a látóköröd a tervezés-kivitelezés témakörben.
Pl. tegyük fel, hogy a Nagy Programozó fraktálokat használt, hogy bizonyos keretek között kitöltse a teret, hogy bizonyos ideák formavilágát variálja, és mindezt több szinten valósította meg (a fraktálokból összeálló 1. szintű formák alkothatják a 2. szint fraktáljainak a kiinduló pontját, és így tovább).

Gorni
Hozzászólások: 894

Intelligent Design - Értelmes Tervezettség (9787)

HozzászólásSzerző: Gorni » 2011.01.07. 00:50

@vaskalapos (9750):
Akkor tetelezz fel tervezot, ha van ra barmi alapod, bizonyitekod.

Nézzünk meg egy egyszerű példát, hogy mikor jogos tervezőt feltételezni.
Már sokszor meg akartam kérdezni, hogy miért nem írsz magyar ékezetekkel. Aztán megtudtam, hogy nem Mo-n élsz, és nyilván, a szgépedben nincs magyar ékezetes készlet. Oké.
De azt is meg akartam kérdezni, hogy miért gépelsz olyan sok hibával (egymás melletti betűket cserélsz, szavakat rosszul írsz le).
A két jelenség közül az egyik tervezett (á helyett a-t írsz, tudatosan, előre tervezetten), míg a másik véletlen (az elütések, betűcserék).
Vajon létezik-e tudományos módszer arra, hogy a két jelenséget valóban meg lehessen különböztetni egymástól? Azaz általánosabban, megkülönböztethetők-e a véletlen okozta változások a tudatosan tervezett változásoktól? Mikor, milyen körülmények, illetve feltételek megléte ad erre lehetőséget, stb.?
Szerintem az Értelmes Tervezettség ezt teszi, megalkotja az elméleti hátterét egy ilyen megkülönböztetésnek.

vaskalapos
Hozzászólások: 4606

Intelligent Design - Értelmes Tervezettség (9793)

HozzászólásSzerző: vaskalapos » 2011.01.07. 01:59

@Gorni (9787):

Ne kritozald agepelsemet. ;-)

Arra gondolsz, hogy egy Intelliges Tervezo vezeti a kezemet amikor gepelek es felreutok?

Vagy arra gondolsz, hogy az ekezetek hianya egy Intelligens Tervezo munkaja, nem az en lustasagom, hogy nem installaltam az ékezetes billentyüzetet?

Honnnn tuod, hoyg mikor vetlen se mikro zsandeks egy hiba?

Tovabbi logikai bakugras, hogy egyertelmuen intelligens (-nek mondott ;-) ember szellemi alkotasat elemzed.

Altalaban nem kulonoztetheto meg a tervezett es a veletlenul, illetve termeszeti torvenyek hatasara, de tervezes es kulso szellemi beavatkozas nelkul bekovetkezo esemeny, babonasag minden mogott tervezot keresni. De az is teny, hogy barmire ra lehet fogni, hogy ezt terveztek (nem tudjuk ki, mikor miert, de biztos terveztek)... csak nincs ertelme az egesznek, sehova sem vezet.

Avatar
pounderstibbons
*
*
Hozzászólások: 2662

Intelligent Design - Értelmes Tervezettség (9794)

HozzászólásSzerző: pounderstibbons » 2011.01.07. 02:05

@Gorni (9787):


De szerinted mennyire tudnád felismerni ha valakinek elromlana a billentyűzetén az á betűje (véletlen hiány), vagy tényleg nem lenne a billentyűzeten á betű (tervezettség)?

Mondj már valami tuti módszert a kettő elkülönítésére...
:D

vaskalapos
Hozzászólások: 4606

Intelligent Design - Értelmes Tervezettség (9795)

HozzászólásSzerző: vaskalapos » 2011.01.07. 02:15

A gepeleses peldaban ez elso es legkomolyabb problema az, hogy eleve egy (allitolag) intelligens leny tudatos tevekenyseget elemzi.

Gorni
Hozzászólások: 894

Intelligent Design - Értelmes Tervezettség (9797)

HozzászólásSzerző: Gorni » 2011.01.07. 04:53

@vaskalapos (9793):
Honnnn tuod, hoyg mikor vetlen se mikro zsandeks egy hiba?

Előveszek egy statisztika tankönyvet, és
1. abból megtanulom a módszereket, amivel ki lehet mutatni a különbséget,
2. ha az adott módszer alkalmazhatóságának feltételei megvalósulnak.
De "egy hiba" esetén ez nem megy.
Hibák sorozatáról beszélhetünk, és véletlennek feltüntetett elütés-sorozatról.
Ezért az evolúció elméletében is azok a részletek ellenőrizhetők, amelyek sorozatot alkotnak, nem egyedi események.
Minél több lépés, minél hosszabb sorozat, annál inkább megbízhatók a statisztikai módszerek.
Ami a nehéz, hogy a valóság "lépéseit" megfelelő módon absztrahálni kell, különben a képletek nem alkalmazhatóak. Mostanra látom, neked ezzel igen nagy ellenérzésed van. Az absztrakcióval. Vannak emberek, akiknél ez a helyzet, a konkrétumokat jól felfogják, nagyon gyakorlatiasak, de ha absztrakcióról, hasonlóságok felismeréséről van szó, akkor szenvednek.
Nehogy már azt hidd, hogy kritizállak :oops: A másság nem ok a kritikára, a hiba sem (elütés).
A szándékos zavar keltése már talán, a tudatos félrevezetés viszont igen, de ezt nem tapasztaltam nálad.


Avatar
pounderstibbons
*
*
Hozzászólások: 2662

Intelligent Design - Értelmes Tervezettség (9804)

HozzászólásSzerző: pounderstibbons » 2011.01.07. 09:11

@Gorni (9797):


Ehhez mit szólnál:
Az evolúció megértéséhez a következők szükségesek:

Előveszek egy statisztikabiológia tankönyvet, és
1. abból megtanulom a módszereket, amelyekkel alátámasztották az evolúciót

Talán inkább itt kellene kezdened. :)

Gorni
Hozzászólások: 894

Intelligent Design - Értelmes Tervezettség (9809)

HozzászólásSzerző: Gorni » 2011.01.07. 09:59

@vaskalapos (9795):
A gepeleses peldaban ez elso es legkomolyabb problema az, hogy eleve egy (allitolag) intelligens leny tudatos tevekenyseget elemzi.

Nem csak azt. A gondolataid megszületése és leírása lehet, hogy intelligens lény tudatos tevékenysége, de hozzátevődnek olyan folyamatok, ahol véletlen változások befolyásolják a kapott üzenetet. Megfelelő módszerekkel és feltételek mellett kimutatható, hogy hol jelenik meg a véletlen hatás. Ritkábban ki is küszöbölhető.
Egy adott betűkészlet esetében statisztikai módszerekkel anélkül is kimutatható a szöveg értelmes eredete, vagy értelem befolyása, hogy a tartalmat nem is ismerjük.

érdeklődő
Hozzászólások: 7

Intelligent Design - Értelmes Tervezettség (9812)

HozzászólásSzerző: érdeklődő » 2011.01.07. 10:13

@Gorni (9786):


Számos hibajavító rész-programot kitaláltak már erre. A DNS-ben is van hibajavító egység, ami igyekszik a mutációkat kiküszöbölni. Egy rendkívül összetett programban (pl. az OP rendszerek) számos sérülést elviselnek. Vannak olyan helyek, ahol valóban végzetes akár csak egyetlen egység megváltozása. De a legtöbb nem ilyen, sőt, lehet olyan programot is tervezni, amelyik betervezetten használja ki a véletlen változások adta variációs lehetőségeket.
Az érzékeny részek az energia ellátás, a jelszinteket meghatározó programok, az alapvető beállítások (honnan vegye a rendszer az indító programot) stb. Beszélgess ügyes programozókkal, akkor szélesebb lesz a látóköröd a tervezés-kivitelezés témakörben.

Itt egy kicsit segíts. OP = operációs rendszerek, vagy OP = OOP = objektum-orientált programozást használó rendszerek?
Mindkettőben lehet ugyanis a fenti gondolatodnak megfelelő módszert találni. Abban tökéletesen egyetértek veled: lehet olyan programot tervezni, hogy betervezetten használja a véletlen változások adta lehetőségeket.
Sőt, ha nekem az itt általad vitatott evolúciót kellene modelleznem, egyértelműen az OOP eszköztárát használnám. Az osztály (általános leíró tervrajz) kódja lenne ebben az analógiában a DNS, és az instanciáknak (példányoknak, vagyis a tényleges memóriaváltozóknak) megengedném, hogy egy osztálymetódussal megváltoztassák az öröklött (kiterjesztett) osztályok kódját. Az ebből példányosodó objektumok már eltérnének az ős-osztálytól. (Ebben gondolom senkinek nem mondok újdonságot, ez az OOP egyik előnye a procedurális nyelvekkel szemben.)
Ha megfelelően állítanám össze a környezetet, ahol a származtatott példányok "túlélési esélye" eltérő, akkor előbb utóbb lennének olyan példányok , amik az adott környezetben jobban működnének, és lennének, amik kevésbé. Amennyiben ennek tétje van, mondjuk van egy „ragadozó” osztály is, aminek példányai „vadásznak” a másik osztály példányaira, valamint a példányok élettartalma véges, akkor előbb utóbb az ős osztálytól teljesen eltérő objektumok lennének. A versenyeztetett algoritmusok evolúciószerű folyamatokat alkotnának.

Pl. tegyük fel, hogy a Nagy Programozó fraktálokat használt, hogy bizonyos keretek között kitöltse a teret, hogy bizonyos ideák formavilágát variálja, és mindezt több szinten valósította meg (a fraktálokból összeálló 1. szintű formák alkothatják a 2. szint fraktáljainak a kiinduló pontját, és így tovább).


Tegyük fel. Nevezzük el az elméletedet fraktál-hipotézisnek. Nézzük meg, hogy az eddigi kutatások eredményeivel összevetve, az ok-okozati összefüggéseket megvizsgálva mennyire üti azok megállapításait. Amennyiben üti, nézzük meg, hogy hol és miért. Nézzük meg, hogy azok, akik ezzel a témával régóta foglalkoznak, mit mondanak erre.

Mert ugye én is mondhatnám, hogy a tűzhelyre feltett víz a „tündérlány lehelet” elméletem szerint attól melegszik fel, hogy láthatatlan lények fújják. Mindezt abból vezettem le, hogy én nem tudom elképzelni, hogy kizárólag a lángtól melegszik fel,--> ezért ez kizárt -->így hát tündérek fújják. (Eddig ID érvelési séma).
Ezzel hipotézis szinten semmi gond. Csakhogy az élet úgy hozta, hogy sokan ok-okozati összefüggést vélnek felfedezni a víz melegedése és a láng között, sőt, egyes elvetemültek még olyan állításokat is alkottak, ahol megfelelő egyenletekkel modellezték a folyamatot, így a jövőre nézve is jóslatokat tudnak tenni arra, hogy mennyi víz felmelegítéséhez meddig kell a lángon tartani. A hipotézisem számára sajnálatos körülmény, hogy a jóslataik rendre beválnak.

Emiatt két lehetőség van. Az egyik, hogy a tündérek mindig konstans fújást adnak hozzá-->tehát nem kell vele számolni, a másik, hogy fújják ugyan, de nem érzékelhető mértékben-->tehát nem kell vele számolni.
Biztos van olyan is, aki azt mondja, hogy nincsenek tündérlányok, de én tudom, hogy vannak, és kész. Egyébként is bizonyítsák be, hogy nincsenek.

Érzed, hogy az iróniámban mennyi tipikus ID-szerű érvelési hibát teszek?

Avatar
pounderstibbons
*
*
Hozzászólások: 2662

Intelligent Design - Értelmes Tervezettség (9816)

HozzászólásSzerző: pounderstibbons » 2011.01.07. 10:31

@Gorni (9809):

Egy adott betűkészlet esetében statisztikai módszerekkel anélkül is kimutatható a szöveg értelmes eredete, vagy értelem befolyása, hogy a tartalmat nem is ismerjük.



Szerinted a DNS-t tervezték.

Akkor meg tudnád állapítani statisztikai módszerrel (tartalom ismerete nélkül!), hogy melyik ATGC elemeket tartalmazó szekvencia származik egy "tervezett" DNS-ből, és melyik véletlenszerű kreálmány?
Hogyhogy nem olvastam még erről sehol egy tanulmányt, ha ez ennyire pofonegyszerű?

vaskalapos
Hozzászólások: 4606

Intelligent Design - Értelmes Tervezettség (9827)

HozzászólásSzerző: vaskalapos » 2011.01.07. 14:22

@pounderstibbons (9816):

Nagyon jo valasz!

Orommel szolgaltatok DNS vagy aminosav sorrend szekvenciakat egy ilyen teszthez!

Avatar
pounderstibbons
*
*
Hozzászólások: 2662

Intelligent Design - Értelmes Tervezettség (9829)

HozzászólásSzerző: pounderstibbons » 2011.01.07. 15:07

@vaskalapos (9827):

Én meg örömmel szolgáltatok véletlenszerű A, T, G és C karaktereket, de hogy ne kelljen Vaskalaposra várnod, feladok egy apró feladatot:

attgatcttcatcgtacgatgcatzcgatcggcgcatcgcgaagcagtctgattgacttcatgcatttttttttctgctagcttctagctacgactgcatg
caccgactgacaccaccagcagcaccaccacaccccgaggattatttgcatcttattatggtatggtatagggtatagggatatgctatcgagtcag
gcgtcgycgcacctgtggtgttcacacatgagtcgaattcagagcaggttcccgtgttagcttaagggtaaacatacaagtcgattgaagatgggt
agggggcttcaaatcgtccagctaaacagtattacaggttgtcactctacagtacctccgagagcaagtagggcaccctgtttgagacvtgatgat
gagttcgaagcggaactatttcgaggggcgagcccacatcgtctcttctgcggatgacttaacacgttagggaggtggagttgattccatcgatgg
ttataaatcaaaaaatcggaacgctgtctggaggatgaatctaacggtgcgtatctcgatcactcagtcgcttttcgtactgcgcgaaagttcgcac
cgctcatacacttggttccgaagcctgtcctgatatatgaatccaaactagagcggggctcttgacgtttggagttgtaaatatctaatattccaatcg
gcttttacgtgcaccaccgcaggcggctgacgagg

A fenti jelentős részben véletlenszerű betűk közepére (nem az első és utolsó sorba, hanem máshova) egy 8 karakteres (számomra) értelmes sorozatot tettem, ami szerintem csak nekem jelent valamit, de nekem biztosan.
Persze te nem tudod ez a sorozat nekem miért fontos, de hát a tervezőről se tudsz semmit, mégis látod a kezenyomát.

Bizonyára könnyen kitalálod melyik ez a 8 karakter, hiszen ezeket egy értelmes tervezés eredményeképpen csempésztem a szövegbe, ellentétben a véletlenszerűen körésorsolt többivel.

Sok sikert a kutatáshoz.
:)

Avatar
Orcas
Hozzászólások: 1027
Tartózkodási hely: Az Operencián túl

Intelligent Design - Értelmes Tervezettség (9834)

HozzászólásSzerző: Orcas » 2011.01.07. 16:42

@pounderstibbons (9829):

A 8 bazis eleg keves, legalabb 16-24 legyen!

Avatar
pounderstibbons
*
*
Hozzászólások: 2662

Intelligent Design - Értelmes Tervezettség (9837)

HozzászólásSzerző: pounderstibbons » 2011.01.07. 17:56

@Orcas (9834):

Olyan szépen összerendeztem, az nem elég, ha a random szöveget megkurtítom?:(

Avatar
pounderstibbons
*
*
Hozzászólások: 2662

Intelligent Design - Értelmes Tervezettség (9844)

HozzászólásSzerző: pounderstibbons » 2011.01.07. 19:18

@pounderstibbons (9837):

De legyen meg Orcas akarata:
Ebben 18 tervezett karakter van egymás után elhelyezve.
Gyűjtsd össze mindet!


CTGGAGAAAATGAAGTTCTATGAGTACGATTTCTTCATTATTATTTCGGCCACACGCTTC
AAGAAAAATGATATAGACATTGCCAAAGCAATCAGCATGATGAAGAAGGAATTCTACTTC
GTGAGAACCAAGGTGGACTCTGACATAACAAATGAAGCAGATGGCAAACCTCAAACCTTT
GACAAAGAAAAGGTCCTGCAGGACATCCGCCTTAACTGTGTGAACACCTTTAGGGAGAAT
GGCATTGCTGAGCCACCAATCTTCCTGCTCTCTAACAAAAATGTTTGTCACTATGACTTC
CCCGTCCTGATGGACAAGCTGATAAGTGACCTCCCTATCTACAAGAGACACAATTTTATG
GTCTCCTTACCCAATATCACAGATTCAGTCATGTGTCATCCAGTAGATATTCAGGATGTG
AGGATTTGGCTGGAAGGATTTGCTGCTGACCTAGTGAATATCATCCCTTCTCTGACCTTT
CTCTTGGACAGTGATTTGGAGAGTTAGGAGATTACATAGGATCACTCTGAAGAAAAGCAT
GGAGTGGATGAAACATCTTTGCAGAGATTAGCTAGGGACTGGGAAATAGAGGTGGATCAG
GTGGAGGCCATGATAAAATCTCCTGCTGTGTTCAAACCTACAGATGAAGAAACAATACAA
TTGATTGAACACTGATTACACTTAACCASTAAAAGGGAATATTCAGTTGACAAACTCTGC
GCATTAAAAGAAATCGATAGTAGTGTGCTCAATGTTGCTGTCACCGGGGAGACGGGATCA
GGGAAGTCCAGCTTCATCAATACCCTGAGAGGCATTGGGAATGAAGAAGAAGGTGCAGCT
AAAACTGGGGTGGTGGAGGTAACCATGGAAAGACATCCATACAAACACCCCAATATACCC
AATGTGGTTTTTTGGGACCTGCCTGGGATTGGAAGCACAAATTTCCCACCAAACACTTAC

Avatar
Gábor
Hozzászólások: 2318
Tartózkodási hely: Finnország

Intelligent Design - Értelmes Tervezettség (9850)

HozzászólásSzerző: Gábor » 2011.01.07. 19:45

@pounderstibbons (9829): agattaca... :D Talált?


vaskalapos
Hozzászólások: 4606

Intelligent Design - Értelmes Tervezettség (9863)

HozzászólásSzerző: vaskalapos » 2011.01.07. 20:46

@pounderstibbons (9844):

erre nezzetek ra (aminosavsorrend, az ordog a reszletekben van elrejtve):

MQGSVTEFLK PRLVDIEQVS STHAKVTLEP LERGFGHTLG NALRRILLSS MPGCAVTEVEIDGVLHEYST KEGVQEDILE ILLNLKGLAV RVQGKDEVIL TLNKSGIGPV TAADITHDGD VEIVKPQHVI CHLTDENASI SMRIKVQRGR GYVPASTRIH SEEDERPIGR LLVDACYSPV ERIAYNVEAA RVEQRTDLDK LVIEMETNGT IDPEEAIRRA ATILAEQLEA FVDLRDVRQ PEVKEEKPEFD PILLRPVDDL ELTVRSANCL KAEAIHYIGD LVQRTEVELL KTPNLGKKSL TEIKDVLASR GLSLGMRLEN WPPASIADE

Avatar
pounderstibbons
*
*
Hozzászólások: 2662

Intelligent Design - Értelmes Tervezettség (9865)

HozzászólásSzerző: pounderstibbons » 2011.01.07. 20:50

@vaskalapos (9863):

Ezt valami torrentsite-ról töltötted?
Legalábbis van benne egy SEEDER, aki ráadásul PIG is :)

Különben tetszik ez az új irány, hogy átmegyünk rejtvénymellékletbe, csak szerintem lassú lesz mire Gorni felnő a feladathoz. :)

vaskalapos
Hozzászólások: 4606

Intelligent Design - Értelmes Tervezettség (9866)

HozzászólásSzerző: vaskalapos » 2011.01.07. 21:00

@pounderstibbons (9865):

sajat

az ordog a reszletekben van elrejtve

Avatar
Gábor
Hozzászólások: 2318
Tartózkodási hely: Finnország

Intelligent Design - Értelmes Tervezettség (9867)

HozzászólásSzerző: Gábor » 2011.01.07. 21:00

@vaskalapos (9863): @vaskalapos (9863): Megvan: MPGCAVTEVEIDGVLHEYST - ez mi? link. :D (Mpg - CAV - TEVE - ID - GLV (?) - HEYST!

Avatar
énkérdezek
Hozzászólások: 505
Tartózkodási hely: Hungary

Intelligent Design - Értelmes Tervezettség (9868)

HozzászólásSzerző: énkérdezek » 2011.01.07. 21:05


Avatar
Orcas
Hozzászólások: 1027
Tartózkodási hely: Az Operencián túl

Intelligent Design - Értelmes Tervezettség (9872)

HozzászólásSzerző: Orcas » 2011.01.07. 21:35

@pounderstibbons (9844):
Igen, de ezen felul meg az is kerdes, hogy amibe beletettel 18 mesterseges bazist, azon tul fellelheto bazisok benne vannak-e egy genben, tehat annak van-e ertelme.

vaskalapos
Hozzászólások: 4606

Intelligent Design - Értelmes Tervezettség (9874)

HozzászólásSzerző: vaskalapos » 2011.01.07. 21:58

@Orcas (9872):
BLAST mondja, hogy ez GENE ID: 60440 Iigp1 | interferon inducible GTPase 1 [Mus musculus]

itt van elteres:
GTGTCATCCAGTAGATATTCAGGATG
meg itt:
GTGATTTGGAGAGTTAGGAGATTACATAGGATCACTCTGAAGAAAAGCAT

Avatar
pounderstibbons
*
*
Hozzászólások: 2662

Intelligent Design - Értelmes Tervezettség (9876)

HozzászólásSzerző: pounderstibbons » 2011.01.07. 22:35

@Orcas (9872):

Nem biztos hogy teljesen értelek, de lehet, hogy te se érted a feladatom lényegét/célját.

1., Gorni állította, hogy képes statisztikai módszerekkel kiszűrni egy véletlenszerű elemekből álló szövegből a tervezett elemeket.
2., Nosza összerántottam egy véletlenszerű "szöveget", (ami ATGC betűkből állva megfelel egy kiolvasott génszekvenciának amiről állítja, hogy felismerhetőek benne a tervezettség jelei) és beletettem (intelligens?) tervezésű szövegemet. Szerintem, ha majd elárulom mi volt az, mindenki látni fogja, hogy mennyire intelligens. ;)
3., A lényeg, hogy ha Gorninak igaza van, ő már azelőtt fogja látni, hogy én elárulnám, és azt is meg fogja tudni mondani, hogy milyen úton jutott erre a következtetésre.

Annyit elárulok, hogy nem fehérjeszintetizálás a kulcsa a szövegemnek, hanem más.
Olyan dolog, amiről ha tudja az ember, hogy tervezett, akkor tud neki jelentést tulajdonítani.
Gorni szerint ő a tartalom ismerte nélkül, csupán statisztikai eszközökkel tisztázni tudja a nem véletlenszerű szöveget. De előre figyelmeztetem, hogy nem elég megtalálnia a szövegrészt, kérném mellé a valószínűségszámítási/statisztikai műveletet is, amivel megtalálta!
Nosza rajta, durálja neki magát.

Mondjuk adok rá neki egy hetet.

Hallod Gorni?

Avatar
Orcas
Hozzászólások: 1027
Tartózkodási hely: Az Operencián túl

Intelligent Design - Értelmes Tervezettség (9877)

HozzászólásSzerző: Orcas » 2011.01.07. 22:41

@pounderstibbons (9876):

Valoban nem ertettem. :( Igazabol azt sem ertem, ahogy Vaskalpos jutott eredmenyre.

vaskalapos
Hozzászólások: 4606

Intelligent Design - Értelmes Tervezettség (9879)

HozzászólásSzerző: vaskalapos » 2011.01.07. 22:47

@pounderstibbons (9876):

Amit beirtal az egy eger gen reszlete, az alatalam megjelolt szakaszok kivetelevel 100%-ban egyezik az interferon altal indukalt GTP bonto ezim genjevel az egerben...

Avatar
SexComb
*
*
Hozzászólások: 388

Intelligent Design - Értelmes Tervezettség (9884)

HozzászólásSzerző: SexComb » 2011.01.08. 08:20

@vaskalapos (9879):

Ez rossz válasz, mint tudjuk, Gorni érvelésének egyik kulcseleme, hogy a hasonlóság/különbözőség semmit sem jelent, szóval nem lehet jó a megfejtés. Hová jutnánk, ha csak úgy egyszerűen összehasonlítanánk egy nukleotidszekvenciát egy másikkal? A végén még elfogadnánk az evolúciót!

Avatar
SexComb
*
*
Hozzászólások: 388

Intelligent Design - Értelmes Tervezettség (9885)

HozzászólásSzerző: SexComb » 2011.01.08. 08:26

Egyébként azt tegyük már hozzá, hogy mindannyian pontosan tudjuk: Nincs olyan matematikai, statisztikai stb. módszer, amivel meg lehetne állapítani egy nukleotidszekvenciáról hogy tervezett -e? Ezt Gorni is pontosan tudja, csak azért hazudik ilyesmit, mert valódi érvei nincsenek.

Avatar
sajnos_kacat
Hozzászólások: 680
Tartózkodási hely: Budapest

Intelligent Design - Értelmes Tervezettség (9886)

HozzászólásSzerző: sajnos_kacat » 2011.01.08. 09:01

@SexComb (9885):
Amikor valaki veletlenszeru karaktersorozatok informaciotartalmarol probal meg okoskodni, en mindig a kinai irast veszem elo peldanak. Ami nekem egy ertelmes mondat, az egy kinainak kusza vonalak halmaza, es ez forditva is igaz. Az informaciotartalom mindig kozmegegyezes es kontextus kerdese. Egy veletlenszeruen kiragadott 20 karakteres aminosav szekvencia informaciotartalma nulla, de ha megmondjuk, hogy a dns melyik szakaszarol szarmazik, akkor lehet akar hajszint kodolo szakasz is.

Gorni
Hozzászólások: 894

Intelligent Design - Értelmes Tervezettség (9912)

HozzászólásSzerző: Gorni » 2011.01.08. 14:07

@SexComb (9885):
Egy kissé szabadon gondolkodva én így ellenőrizném a véletlenszerűséget:

Az összes karakter 4 elemből állhat. A legyen 1, C legyen 2, T legyen 3, G legyen 4-el jelölve.

1. próba: Adjuk össze a számokat, n elem esetében (legyen a könnyebbség kedvéért 4-el osztható) az eredmény 10xn közelében kell legyen. Ha az eredmény (y) eltérése kisebb, mint az előre választott kockázati érték (amilyen kockázatot vállalunk a döntésünk meghozatalával), akkor a sorozatot elfogadjuk véletlen által generáltnak (nem mutatható ki tudatos manipulálás). A szakirodalom 0.05, 0.01 vagy 0.005 értéket javasol a szignifikancia szintjére.

(Y-10n) / 10n = s.

Természetesen ahhoz, hogy meggyőzően elváljon a véletlen generátorral előállított sorozat a tudatosan tervezettől, a tervezőnek nem szabad ismernie ezeket a teszteket, (hiszen akkor utólag belerak még betűket, amivel elfedi a manipulációját) és elég hosszúnak kell lennie a sorozatnak ahhoz, hogy a kiértékelés során már szignifikáns eltérés legyen tapasztalható a véletlen és a tudatosan manipulált számsorozat között.

2. próba: Ha az első próba negatív (tehát s<0.005), akkor megnézhetjük a következőt:
A, C, T, G elvben azonos arányban fordul elő? Vagy van valamilyen kísérletileg meghatározott eltérés?
Ha elvben azonos arányban fordulnak elő, akkor minden egyes betűre (molekulára) ellenőrizni lehet, hogy az adott sorozatban mennyivel tér el az előfordulási aránya a 25%-tól. Ha a kísérleti eredmények alapján már eleve adott egy eltérés, akkor azt kell figyelembe venni. Megint kiszámolhatjuk a szignifikancia szintet sa, sc, st és sg-re.

3. próba: párokba rendezhetjük a molekulákat, ha a kísérletek alapján bármelyik következhet bármelyik után, és a párok elméleti és valódi előfordulási gyakoriságát hasonlítjuk össze.

Gondolom statisztikusok javasolnának még néhány próbát, nem mentem bele mélyen a szakirodalomba.
Akinek van ideje, ellenőrizheti az adott sorozatokat a fenti próbákkal. Jó számolást.

Avatar
pounderstibbons
*
*
Hozzászólások: 2662

Intelligent Design - Értelmes Tervezettség (9915)

HozzászólásSzerző: pounderstibbons » 2011.01.08. 15:41

@Gorni (9912):

Nekem kicsit furcsa, hogy leírod ide a remekívű elképzelésedet, és nem állsz neki a számolásnak.

Mellesleg az ATGC-k eloszlása nem pontosan 1/4-1/4 tudtommal, ami bizonyára megnehezíti a képleteid alkalmazását.

De mondom, állj neki és keress tervezettséget a fenti szövegekben vagy ne tegyél alaptalan kijelentéseket a tervezettség fellelhetőségéről, mert így csak segget csinálsz a szádból.

Az, pedig, hogy feltételezed, hogy a tervező nem ismerné a tervezettség jeleinek eltitkolására módszereket több okból is fura.
Kezdjük azzal, hogy Ti feltételezitek, hogy a tervező baromi okos (egyik legutóbbi Értem szösszenetben 700milliárdos IQ-t jósoltak neki), így bizonyára mindenféle "titkosítást" ismer. De akkor mégis miért mondod, hogy rá lehet akadni a tervező nyomaira. Okosabbak lennének az ID-sek, mint a tervező? Ha igen, akkor ennek elég kevés jelét adják...

Gorni
Hozzászólások: 894

Intelligent Design - Értelmes Tervezettség (9916)

HozzászólásSzerző: Gorni » 2011.01.08. 15:44

@pounderstibbons (9829):
örömmel szolgáltatok véletlenszerű A, T, G és C karaktereket

Egyrészt vigyázhattál volna, hogy ne hibázz.
Két helyen z-t, egy helyen y-t írtál. A z-t t-nek veszem, az y-t a-nak.
Az első próbán átment a sorozat.
A második próba alapján a C gyanús, jelentősen kevesebb van belőle az elvárhatónál, de a T és a G is eltér az átlagtól.
A harmadik próbát (párok) most számolom. Nagyon lassú, nem biztos, hogy lesz rá türelmem programok nélkül végigszámolni. Egyenlőre ami már megvan: a CC párokból van jelentősen kevesebb az elvárhatónál.

Gorni
Hozzászólások: 894

Intelligent Design - Értelmes Tervezettség (9917)

HozzászólásSzerző: Gorni » 2011.01.08. 15:49

@pounderstibbons (9915):
Nekem kicsit furcsa, hogy leírod ide a remekívű elképzelésedet, és nem állsz neki a számolásnak.
Mellesleg az ATGC-k eloszlása nem pontosan 1/4-1/4 tudtommal, ami bizonyára megnehezíti a képleteid alkalmazását.

Ha tudnád, hogy mennyi időbe telik, és a végeredmény mennyire nem fog meghatni, nem kérnél ilyet. De mint jeleztem, belekezdtem.
Az eloszlás valószínűségével kapcsolatban előbb is szólhattál volna. Nem nagy gond, mert csak be kell helyettesíteni a megfelelő értéket a képletbe, de valóban módosítani fogja a döntés kockázatát.
Most akkor mondd meg, hogy a párok valószínűsége egyenlő-e a kísérletek alapján, vagy van valami eltérés, mielőtt túl sokat számolnék.
Ja, az elképzelésem nem remek ívű, csak egyszerű logika alapján került felvázolásra. A szakemberek minden bizonnyal nevetnének rajta, nekik már kifinomultabb módszereik is vannak.
Ja, miért trükközött volna a tervező? Megcsinálta a kódokat, és kész. Ha csupán betömörítette őket, ahogy mi is tesszük a zip vagy rar file-okkal, máris véletlennek fog tűnni statisztikailag az egész, csak kicsomagolás után lehet felismerni a szignifikáns eltérést. Ha akarod, nézz utána az informatikában, miért van így.

Avatar
pounderstibbons
*
*
Hozzászólások: 2662

Intelligent Design - Értelmes Tervezettség (9921)

HozzászólásSzerző: pounderstibbons » 2011.01.08. 16:03

@Gorni (9917):

Nagyon helyes, hogy dolgozol rajta, legmélyebb respect neked ezért. Tényleg.

Várom az eredményt.

Az 1/4-től eltérő arány az élőlények DNS-ére vonatkozik tudtommal, de a fenti szövegekben is kötve hiszem, hogy megvalósulna.

Avatar
Caspi
Hozzászólások: 860

Intelligent Design - Értelmes Tervezettség (9924)

HozzászólásSzerző: Caspi » 2011.01.08. 16:23

@Gorni (9916):
A második próba alapján a C gyanús, jelentősen kevesebb van belőle az elvárhatónál, de a T és a G is eltér az átlagtól.

Mielőtt túlzottan belemerülsz, fogj egy dobókockát, dobjál egy százas sorozatot és elemezd ki azt is... :idea:


Vissza: “Intelligens tervezettség”

Ki van itt

Jelenlévő fórumozók: nincs regisztrált felhasználó valamint 0 vendég